B. B. Ward

Publication List Details

Period

1997 - 2009

Number

20

Co-Authors

Denitrification as the dominant nitrogen loss process in the Arabian Sea (2009)

Ward, B.B., Devol, A.H., Rich, J.J., Chang, B.X., Bulow, S.E., Naik, H., ...

Primary production in over half of the world’s oceans is limited by fixed nitrogen availability. The main loss term from the fixed nitrogen inventory is the production of dinitrogen gas (N sub(2))...

2005. Relationship of temporal and spatial variabilities of ammonia-oxidizing bacteria to nitrification rates in Monterey (2008)

G. D. O’mullan, B. B. Ward

Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...

Organic carbon, and not copper, controls denitrification in oxygen minimum zones of the ocean (2008)

Ward, B.B., Tuit, C.B., Jayakumar, A., Rich, J.J., Moffett, J., Naqvi, S.W.A.

Incubation experiments under trace metal clean conditions and ambient oxygen concentrations were used to investigate the response of microbial assemblages in oxygen minimum zones (OMZs) to additions...

Diversity of nitrite reductase genes (nirS) in the denitrifying water column of the coastal Arabian Sea (2004)

Jayakumar, D.A., Francis, C.A., Naqvi, S.W.A., Ward, B.B.

Denitrification often occurs in the water column, underlying zones of intense productivity and decomposition in upwelling regions. In the denitrifying zone off the southwest coast of India, high...

Phylogenetic diversity of natural populations of ammonia oxidizers investigated by specific PCR amplication (1997)

Ward,B. B., Voytek,M. A.

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer...

Phylogenetic diversity of natural populations of ammonia oxidizers investigated by specific PCR amplication (1997)

Ward, B. B., Voytek, M. A.

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer...

Analysis of Ammonia-Oxidizing Bacteria from Hypersaline Mono Lake, California, on the Basis of 16S rRNA Sequences

Ward, B. B., Martino, D. P., Diaz, M. C., Joye, S. B.

Ammonia-oxidizing bacteria were detected by PCR amplification of DNA extracted from filtered water samples throughout the water column of Mono Lake, California. Ammonia-oxidizing members of the β...

Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.

Voytek, M A, Ward, B B

The PCR was used as the basis for the development of a sensitive and specific assay for the detection of ammonium-oxidizing bacteria belonging to the beta-subclass of the class Proteobacteria. PCR...

Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.

Voytek, M A, Ward, B B

Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."

Comparison of Nucleic Acid Hybridization and Fluorometry for Measurement of the Relationship between RNA/DNA Ratio and Growth Rate in a Marine Bacterium

Kerkhof, L., Ward, B. B.

Continuous culture of Pseudomonas stutzeri Zobell, a marine denitrifying bacterium, was used to determine the relationship between growth rate and nucleic acid content. The trend of decreasing RNA...

Marine Ammonia- and Nitrite-Oxidizing Bacteria: Serological Diversity Determined by Immunofluorescence in Culture and in the Environment

Ward, B. B., Carlucci, A. F.

Immunofluorescence assays for marine ammonium- and nitrite-oxidizing bacteria were used to assess the diversity of nitrifying bacteria isolated from marine environments. The antisera show relatively...

Immunofluorescent Assay for the Marine Ammonium-Oxidizing Bacterium Nitrosococcus oceanus†

Ward, B. B., Perry, M. J.

Nitrification is one of the important microbiological transformations of nitrogen in the ocean. Traditional enrichment-culture methods for enumerating the autotrophic bacteria which oxidize ammonium...

Relationship of Temporal and Spatial Variabilities of Ammonia-Oxidizing Bacteria to Nitrification Rates in Monterey Bay, California

O'Mullan, G. D., Ward, B. B.

Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...

Analysis of Ammonia-Oxidizing Bacteria from Hypersaline Mono Lake, California, on the Basis of 16S rRNA Sequences

Ward, B. B., Martino, D. P., Diaz, M. C., Joye, S. B.

Ammonia-oxidizing bacteria were detected by PCR amplification of DNA extracted from filtered water samples throughout the water column of Mono Lake, California. Ammonia-oxidizing members of the β...

Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.

Voytek, M A, Ward, B B

The PCR was used as the basis for the development of a sensitive and specific assay for the detection of ammonium-oxidizing bacteria belonging to the beta-subclass of the class Proteobacteria. PCR...

Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.

Voytek, M A, Ward, B B

Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."

Comparison of Nucleic Acid Hybridization and Fluorometry for Measurement of the Relationship between RNA/DNA Ratio and Growth Rate in a Marine Bacterium

Kerkhof, L., Ward, B. B.

Continuous culture of Pseudomonas stutzeri Zobell, a marine denitrifying bacterium, was used to determine the relationship between growth rate and nucleic acid content. The trend of decreasing RNA...

Marine Ammonia- and Nitrite-Oxidizing Bacteria: Serological Diversity Determined by Immunofluorescence in Culture and in the Environment

Ward, B. B., Carlucci, A. F.

Immunofluorescence assays for marine ammonium- and nitrite-oxidizing bacteria were used to assess the diversity of nitrifying bacteria isolated from marine environments. The antisera show relatively...

Immunofluorescent Assay for the Marine Ammonium-Oxidizing Bacterium Nitrosococcus oceanus†

Ward, B. B., Perry, M. J.

Nitrification is one of the important microbiological transformations of nitrogen in the ocean. Traditional enrichment-culture methods for enumerating the autotrophic bacteria which oxidize ammonium...

Relationship of Temporal and Spatial Variabilities of Ammonia-Oxidizing Bacteria to Nitrification Rates in Monterey Bay, California

O'Mullan, G. D., Ward, B. B.

Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...