Denitrification as the dominant nitrogen loss process in the Arabian Sea (2009)
Ward, B.B., Devol, A.H., Rich, J.J., Chang, B.X., Bulow, S.E., Naik, H., ...
Primary production in over half of the world’s oceans is limited by fixed nitrogen availability. The main loss term from the fixed nitrogen inventory is the production of dinitrogen gas (N sub(2))...
Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...
Organic carbon, and not copper, controls denitrification in oxygen minimum zones of the ocean (2008)
Ward, B.B., Tuit, C.B., Jayakumar, A., Rich, J.J., Moffett, J., Naqvi, S.W.A.
Incubation experiments under trace metal clean conditions and ambient oxygen concentrations were used to investigate the response of microbial assemblages in oxygen minimum zones (OMZs) to additions...
Jayakumar, D.A., Francis, C.A., Naqvi, S.W.A., Ward, B.B.
Denitrification often occurs in the water column, underlying zones of intense productivity and decomposition in upwelling regions. In the denitrifying zone off the southwest coast of India, high...
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer...
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer...
Ward, B. B., Martino, D. P., Diaz, M. C., Joye, S. B.
Ammonia-oxidizing bacteria were detected by PCR amplification of DNA extracted from filtered water samples throughout the water column of Mono Lake, California. Ammonia-oxidizing members of the β...
The PCR was used as the basis for the development of a sensitive and specific assay for the detection of ammonium-oxidizing bacteria belonging to the beta-subclass of the class Proteobacteria. PCR...
Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."
Continuous culture of Pseudomonas stutzeri Zobell, a marine denitrifying bacterium, was used to determine the relationship between growth rate and nucleic acid content. The trend of decreasing RNA...
Immunofluorescence assays for marine ammonium- and nitrite-oxidizing bacteria were used to assess the diversity of nitrifying bacteria isolated from marine environments. The antisera show relatively...
Immunofluorescent Assay for the Marine Ammonium-Oxidizing Bacterium Nitrosococcus oceanus†
Nitrification is one of the important microbiological transformations of nitrogen in the ocean. Traditional enrichment-culture methods for enumerating the autotrophic bacteria which oxidize ammonium...
Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...
Ward, B. B., Martino, D. P., Diaz, M. C., Joye, S. B.
Ammonia-oxidizing bacteria were detected by PCR amplification of DNA extracted from filtered water samples throughout the water column of Mono Lake, California. Ammonia-oxidizing members of the β...
The PCR was used as the basis for the development of a sensitive and specific assay for the detection of ammonium-oxidizing bacteria belonging to the beta-subclass of the class Proteobacteria. PCR...
Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."
Continuous culture of Pseudomonas stutzeri Zobell, a marine denitrifying bacterium, was used to determine the relationship between growth rate and nucleic acid content. The trend of decreasing RNA...
Immunofluorescence assays for marine ammonium- and nitrite-oxidizing bacteria were used to assess the diversity of nitrifying bacteria isolated from marine environments. The antisera show relatively...
Immunofluorescent Assay for the Marine Ammonium-Oxidizing Bacterium Nitrosococcus oceanus†
Nitrification is one of the important microbiological transformations of nitrogen in the ocean. Traditional enrichment-culture methods for enumerating the autotrophic bacteria which oxidize ammonium...
Temporal and spatial dynamics of ammonia-oxidizing bacteria (AOB) were examined using genes encoding 16S rRNA and ammonia monooxygenase subunit A (AmoA) in Monterey Bay, Calif. Samples were collected...