M. Sugiura

Publication List Details

Period

1980 - 2005

Number

135

Co-Authors

The 1.6 angstrom resolution structure of Fe-superoxide dismutase from the thermophilic cyanobacterium Thermosynechococcus elongatus (2003)

Kerfeld, Cheryl A, Yoshida, S, Tran, K T, Yeates, T O, Cascio, D, Bottin, H, ...

The iron-containing superoxide dismutase (FeSOD) from the thermophilic cyanobacterium Thermosynechococcus elongatus has been isolated. The protein crystallizes readily and we have determined the...

Medial temporal lobe activation during context-dependent relational processes in episodic retrieval: an fMRI study (2002)

Tsukiura, T., Fujii, T., Takahashi, T., Xiao, R., Sugiura, M., Okuda, J., ...

Previous studies have reported that the medial temporal lobe (MTL) structures contribute to the processing of relations among multiple stimuli in episodic encoding. There have been few studies,...

Brain activation during the fist-edge-palm test: a functional MRI study (2002)

Umetsu, A., Okuda, J., Fujii, T., Tsukiura, T., Nagasaka, T., Yanagawa, I., ...

The purpose of our study is to clarify, using functional MRI, brain regions activated during the fist-edge-palm task (FEP) compared to relatively simple hand motor tasks using either the right or the...

Functional delineation of the human occipito-temporal areas related to face and scene processing: A PET study (2000)

Nakamura, K., Kawashima, R., Sato, N., Nakamura, A., Sugiura, M., Kato, T., ...

By measuring regional cerebral blood flow using PET, we delineated the roles of the occipito-temporal regions activated by faces and scenes. We asked right-handed normal subjects to perform three...

The effect of Majorana phase in degenerate neutrinos (1999)

Haba, N., Matsui, Y., Okamura, N., Sugiura, M.

There are physical Majorana phases in the lepton flavor mixing matrix when neutrinos are Majorana fermions. In the case of two degenerate neutrinos, the physical Majorana phase plays the crucial role...

Energy-Scale Dependence of the Lepton-Flavor-Mixing Matrix (1999)

Haba, N., Matsui, Y., Okamura, N., Sugiura, M.

We study an energy-scale dependence of the lepton-flavor-mixing matrix in the minimal supersymmetric standard model with the effective dimension-five operators which give the masses of neutrinos. We...

Distributions of Aurora and Ionospheric Currents Observed Simultaneously on a Global Scale. (1998)

Craven,J. D., Kamide,Y., Frank,L. A., Akasofu,S. I., Sugiura,M.

The instantaneous spatial distribution of auroral emissions is observed with auroral imaging photometers on board the spacecraft Dynamics Explorer 1 (DE 1) as ground-based meridian chains of...

ELECTRICAL AND OPTICAL PROPERTIES OF ION-IRRADIATED ORGANIC POLYMER KAPTON H. (1998)

HIOKI, T., NODA, S., SUGIURA, M., KAKENO, M., YAMADA, K.

An organic polymer Kapton H film was irradiated with high-energy (about MeV) N(2)(+) ions. The specific resistivity of the film irradiated to a dose about 10(17) N/cm(2) was estimated to be about...

The renormalization group analysis of the large lepton flavor mixing and the neutrino mass (1998)

Haba, N., Okamura, N., Sugiura, M.

The Superkamiokande experiment suggests the large flavor mixing between nu_mu and nu_tau. We show that the mixing angle receives significant corrections from the renormalization group equation (RGE)...

Fermion Mass Generation in the D-dimensional Thirring Model as a Gauge Theory (1996)

Sugiura, M.

Based on the Schwinger-Dyson (SD) equation, the fermion mass generation is further studied in the D(2

Nucleic acid-binding specificities of tobacco chioroplast ribonucleoproteins (1991)

Li, Y., Sugiura, M.

Nucleic Acids Research, 19, pp. 2893–2896 (1991) The publishers wish to apologize for the inadvertant omission of this article from the table of contents and index for issue number 11. Details of...

The nucleotide sequences of two tRNAAsn genes from tobacco chloroplasts (1981)

Kato, A., Shimada, H., Kusuda, Mie, Sugiura, M.

Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNAAsn in their 1.4 and...

Sequence of a putative promoter region for the rRNA genes of tobacco chloroplast DNA (1981)

Tohdoh, N., Shinozaki, K., Sugiura, M.

The nucleotide sequence of the segment of tobacco chloroplast DNA adjacent to and including the start of the 16S rRNA gene has been determined. The region just preceding this gene was found to...

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts (1980)

Takaiwa, F., Sugiura, M.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be:...

Elongation of oligonucleotides in the 3'-direction with activated mononucleotides and their analogs using RNA ligase (1980)

Ohtsuka, E., Miyake, T., Nagao, K., Uemura, H., Nishikawa, S., Nagao, K., ...

P1-Adenosine 5′-P2 ,3′-ethoxymethylidene nucleosides [A(5′)ppN from four common nucleosides have been prepared and used for single addition of nucleotides to elongate oligo-nucleotide chains in...

Creation of a novel protein-coding region at the RNA level in black pine chloroplasts: the pattern of RNA editing in the gymnosperm chloroplast is different from that in angiosperms.

Wakasugi, T, Hirose, T, Horihata, M, Tsudzuki, T, Kössel, H, Sugiura, M

The phenomenon of RNA editing has been found to occur in chloroplasts of several angiosperm plants. Comparative analysis of the entire nucleotide sequence of a gymnosperm [Pinus thunbergii (black...

Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein.

Imai, S, Koizumi, S, Sugiura, M, Tokunaga, M, Uemura, Y, Yamamoto, N, ...

In 1000 primary gastric carcinomas, 70 (7.0%) contained Epstein-Barr virus (EBV) genomic sequences detected by PCR and Southern blots. The positive tumors comprised 8 of 9 (89%) undifferentiated...

High-level expression of human superoxide dismutase in the cyanobacterium Anacystis nidulans 6301.

Takeshima, Y, Takatsugu, N, Sugiura, M, Hagiwara, H

A chemically synthesized gene encoding human CuZn superoxide dismutase (hSOD) was cloned into the shuttle vector pBAX18R and expressed in Anacystis nidulans 6301 (Synechococcus sp. strain PCC 6301)...

Loss of all ndh genes as determined by sequencing the entire chloroplast genome of the black pine Pinus thunbergii.

Wakasugi, T, Tsudzuki, J, Ito, S, Nakashima, K, Tsudzuki, T, Sugiura, M

The complete nucleotide sequence (119,707 bp) of the black pine (Pinus thunbergii) chloroplast genome has been determined. It contains 4 rRNA genes and 32 tRNA genes. To our knowledge, the tRNAPro...

Identification of two essential sequence elements in the nonconsensus type II PatpB-290 plastid promoter by using plastid transcription extracts from cultured tobacco BY-2 cells.

Kapoor, S, Sugiura, M

In higher plants, plastid genes are transcribed by at least two types of DNA-dependent RNA polymerases. One of them is the well-known plastid-encoded prokaryotic type of polymerase that recognizes...

Plant cytosolic tRNAHis possesses an exceptional C54 in the canonical TPsiC loop.

Akama, K, Yukawa, Y, Sugiura, M, Small, I

A nuclear gene coding for tRNAHis from Arabidopsis has been reported to contain C54in the TPsiC loop, although the corresponding nucleotide is an invariant U or a derivative in nearly all other...

Molecular heterogeneity of photosystem I. psaD, psaE, psaF, psaH, and psaL are all present in isoforms in Nicotiana spp.

Obokata, J, Mikami, K, Hayashida, N, Nakamura, M, Sugiura, M

The protein composition of photosystem I (PSI) was examined in Nicotiana spp. by high-resolution polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and immunoblot analysis. Five...

Spontaneous establishment of an Epstein-Barr virus-infected fibroblast line from the synovial tissue of a rheumatoid arthritis patient.

Koide, J, Takada, K, Sugiura, M, Sekine, H, Ito, T, Saito, K, ...

An Epstein-Barr virus (EBV)-infected fibroblast line, designated DSEK, was spontaneously established from synovial tissue of a patient with rheumatoid arthritis (RA). DSEK cells expressed EBV nuclear...

Proline-hyperproducing strains of Serratia marcescens: enhancement of proline analog-mediated growth inhibition by increasing osmotic stress.

Sugiura, M, Kisumi, M

Proline-producing strains of Serratia marcescens were more osmotolerant than wild-type strains. Growth inhibition by proline analogs was significantly enhanced by increasing the osmotic stress of the...

Stabilization of a histidine-producing strain of Serratia marcescens.

Sugiura, M, Kisumi, M

A decrease in histidine productivity was observed during subculture of a histidine-producing strain of Serratia marcescens. The decrease was accompanied by an increase in the number of wild-type...

Norleucine accumulation by a norleucine-resistant mutant of Serratia marcescens.

Kisumi, M, Sugiura, M, Chibata, I

A norleucine-resistant mutant was derived from an isoleucine-valine auxotroph of a leucine accumulator of Serratia marcescens. The norleucine-resistant mutant could accumulate norleucine from...

Rapid detection of the mecA gene in methicillin-resistant staphylococci by enzymatic detection of polymerase chain reaction products.

Ubukata, K, Nakagami, S, Nitta, A, Yamane, A, Kawakami, S, Sugiura, M, ...

In order to identify methicillin-resistant staphylococci from clinical sources with ease and reliability, enzymatic detection of polymerase chain reaction (ED-PCR) was applied. ED-PCR is based on the...

DNA-DEPENDENT RNA-DIRECTED PROTEIN SYNTHESIS in vitro, I. EXTENT OF GENOME TRANSCRIPTION*

Bryan, R. N., Sugiura, M., Hayashi, M.

We have described an in vitro system which couples UTP incorporation into RNA by DNA-dependent RNA polymerase with RNA-directed amino acid incorporation into polypeptides. Using the technique of...

The existence of eukaryotic ribonucleoprotein consensus sequence-type RNA-binding proteins in a prokaryote, Synechococcus 6301.

Sugita, M, Sugiura, M

A group of proteins containing a conserved ribonucleoprotein consensus sequence (RNP-CS)-type RNA-binding domain (CS-RBD) of approximately 80 amino acids is present in eukaryotic cells and binds...

cDNA structure, expression and nucleic acid-binding properties of three RNA-binding proteins in tobacco: occurrence of tissue-specific alternative splicing.

Hirose, T, Sugita, M, Sugiura, M

Three cDNAs encoding RNA-binding proteins were isolated from a tobacco (Nicotiana sylvestris) cDNA library. The predicted proteins (RGP-1) are homologous to each other and consist of a...

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

Hori, H, Osawa, S, Takaiwa, F, Sugiura, M

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the...

The complete nucleotide sequence of a rice 17S rRNA gene.

Takaiwa, F, Oono, K, Sugiura, M

The complete nucleotide sequence of a rice nuclear 17S rRNA gene (rDNA) has been determined. The rice rDNA is 1812 bp long and its G + C content is 51.3%. This nucleotide sequence shows 79%, 80% and...

Locations and sequences of tobacco chloroplast genes for tRNAPro(UGG), tRNATrp, tRNAfMet and tRNAGly(GCC): the tRNAGly contains only two base-pairs in the D stem.

Ohme, M, Kamogashira, T, Shinozoki, K, Sugiura, M

The nucleotide sequences of tobacco chloroplast genes for tRNAPro(UGG), tRNATrp, tRNAfMet and tRNAGly(GCC) have been determined. None of these genes contains an intron. One unusual feature is that...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

Takaiwa, F, Kusuda, M, Sugiura, M

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be:...

Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

Takaiwa, F, Sugiura, M

The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which...

Sequence of the intercistronic region between the ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit and coupling factor beta subunit gene.

Shinozaki, K, Sugiura, M

The nucleotide sequence of the region between the genes for the large subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase and the beta subunit of coupling factor from tobacco chloroplast DNA...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Takaiwa, F, Sugiura, M

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence...

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU -...

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

Takaiwa, F, Sugiura, M

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be:...

A putative gene of tobacco chloroplast coding for ribosomal protein similar to E. coli ribosomal protein S19.

Sugita, M, Sugiura, M

A partial sequence of a cloned 3.2 Md BamHI fragment from tobacco chloroplast DNA revealed the occurrence of a putative gene for ribosomal protein. The putative gene is located on the left margin of...

Nucleotide sequence of tobacco chloroplast gene for the alpha subunit of proton-translocating ATPase.

Deno, H, Shinozaki, K, Sugiura, M

The tobacco chloroplast gene for the alpha subunit of proton-translocating ATPase has been cloned and sequenced. The coding region contains 1521 bp (507 codons). The nucleotide sequence and the...

The gene for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase is located close to the gene for the large subunit in the cyanobacterium Anacystis nidulans 6301.

Shinozaki, K, Sugiura, M

The gene for the small subunit (SS) of ribulose-1,5-bisphosphate carboxylase/oxygenase from a cyanobacterium, Anacystis nidulans 6301, has been cloned and subjected to sequence analysis. The SS...

The nucleotide sequences of tRNASer (GCU) and tRNAGln (UUG) genes from tobacco chloroplasts.

Deno, H, Sugiura, M

The nucleotide sequence of tobacco chloroplast genes for tRNASer (GCU) and tRNAGln (UUG) have been determined. These tRNA genes are encoded on the same DNA strand and separated by 1144 bp. Two open...

Nucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC): the tRNAVal (UAC) gene contains a long intron.

Deno, H, Kato, A, Shinozaki, K, Sugiura, M

The nucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC) have been determined. The tRNAVal gene contains a 571 base pairs intron located in the anticodon loop....

Elongation of oligonucleotides in the 3'-direction with activated mononucleotides and their analogs using RNA ligase.

Ohtsuka, E, Miyake, T, Nagao, K, Uemura, H, Nishikawa, S, Sugiura, M, ...

P1-Adenosine 5'-P2-2',3'-ethoxymethylidene nucleosides [A(5')ppN(Em)] from four common nucleosides have been prepared and used for single addition of nucleotides to elongate oligonucleotide chains in...

Sequence of a putative promoter region for the rRNA genes of tobacco chloroplast DNA.

Tohdoh, N, Shinozaki, K, Sugiura, M

The nucleotide sequence of the segment of tobacco chloroplast DNA adjacent to and including the start of the 16S rRNA gene has been determined. The region just preceding this gene was found to...

The nucleotide sequences of two tRNAAsn genes from tobacco chloroplasts.

Kato, A, Shimada, H, Kusuda, M, Sugiura, M

Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNAAsn in their 1.4 and...

Nucleic acid-binding specificities of tobacco chloroplast ribonucleoproteins.

Li, Y Q, Sugiura, M

Many ribonucleoproteins (RNPs) are involved in the regulation of gene expression at the post-transcriptional level. We previously isolated three nuclear-encoded RNPs from tobacco chloroplasts. Here...

Tobacco nuclear gene for the 31 kd chloroplast ribonucleoprotein: genomic organization, sequence analysis and expression.

Li, Y Q, Ye, L Z, Sugita, M, Sugiura, M

We have previously identified three chloroplast ribonucleoproteins and characterized their cDNAs. Here we present the genomic organization, sequence and expression of one of their genes. The 31 kd...

Diversity of a ribonucleoprotein family in tobacco chloroplasts: two new chloroplast ribonucleoproteins and a phylogenetic tree of ten chloroplast RNA-binding domains.

Ye, L H, Li, Y Q, Fukami-Kobayashi, K, Go, M, Konishi, T, Watanabe, A, ...

Two new ribonucleoproteins (RNPs) have been identified from a tobacco chloroplast lysate. These two proteins (cp29A and cp29B) are nuclear-encoded and have a less affinity to single-stranded DNA as...

Fine structural features of the chloroplast genome: comparison of the sequenced chloroplast genomes.

Shimada, H, Sugiura, M

The entire nucleotide sequences of the rice, tobacco and liverwort chloroplast genomes have been determined. We compared all the chloroplast genes, open reading frames and spacer regions in the...

Domains required for nucleic acid binding activities in chloroplast ribonucleoproteins.

Ye, L, Sugiura, M

Five ribonucleoproteins (or RNA-binding proteins) from tobacco chloroplasts have been identified to date; each of these contains an acidic N-terminal domain (24-64 amino acids) and two conserved...

An additional promoter within the protein-coding region of the psbD-psbC gene cluster in tobacco chloroplast DNA.

Yao, W B, Meng, B Y, Tanaka, M, Sugiura, M

Transcription of the psbD-psbC gene cluster in tobacco chloroplasts has been studied. This cluster contains in linear sequence the overlapping genes encoding the D2 and 43 kDa proteins of Photosystem...

Structure and cotranscription of tobacco chloroplast genes for tRNAGlu(UUC), tRNATyr(GUA) and tRNAAsp(GUC).

Ohme, M, Kamogashira, T, Shinozaki, K, Sugiura, M

The location and nucleotide sequences of tobacco chloroplast genes for tRNAGlu(UUC), tRNATyr(GUA) and tRNAAsp(GUC) have been determined. These genes lie midway between the genes for alpha and...

Joining of ribooligonucleotides with T4 RNA ligase and identification of the oligonucleotide-adenylate intermediate.

Ohtsuka, E, Nishikawa, S, Sugiura, M, Ikehara, M

T4 RNA ligase was found to join A-A-A-A-A-A and 32pU-U-U-U in the presence of ATP as cofactor. In this reaction the pyrophosphate of pU-U-U-U and pA was isolated by chromatography on a RPC-5 column,...

Genes for the eight ribosomal proteins are clustered on the chloroplast genome of tobacco (Nicotiana tabacum): similarity to the S10 and spc operons of Escherichia coli.

Tanaka, M, Wakasugi, T, Sugita, M, Shinozaki, K, Sugiura, M

The nucleotide sequence of a tobacco (Nicotiana tabacum) chloroplast gene cluster that encodes eight proteins homologous to Escherichia coli ribosomal proteins L23, L2, S19, L22, S3, L16, L14, and S8...

A novel RNA gene in the tobacco plastid genome: its possible role in the maturation of 16S rRNA.

Vera, A, Sugiura, M

A small plastid-encoded RNA (spRNA, 218 nt) has been detected in tobacco. The corresponding locus (sprA) does not contain any open reading frame and is actively transcribed from its own promoter, as...

A plant basal in vitro system supporting accurate transcription of both RNA polymerase II- and III-dependent genes: supplement of green leaf component(s) drives accurate transcription of a light-responsive rbcS gene.

Fan, H, Sugiura, M

An in vitro transcription initiation system has been developed from nuclei of rapidly growing, non-green tobacco (Nicotiana tabacum) cultured (BY-2) cells. Conditions for nuclear extraction and in...

Cis-acting elements and trans-acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts.

Hirose, T, Sugiura, M

Translational regulation is an important step of gene expression in chloroplasts. To analyze biochemical mechanisms of translational regulation unique to higher plant chloroplasts, an in vitro...

Three distinct ribonucleoproteins from tobacco chloroplasts: each contains a unique amino terminal acidic domain and two ribonucleoprotein consensus motifs.

Li, Y Q, Sugiura, M

Chloroplasts contain their own genetic system. Eighteen different split genes have been found among approximately 130 chloroplast genes from higher plants. However, little is known about the...

Identification of the reaction products of the purified hyaluronidase from stonefish (Synanceja horrida) venom.

Sugahara, K, Yamada, S, Sugiura, M, Takeda, K, Yuen, R, Khoo, H E, ...

Recently we purified to homogeneity hyaluronidase from stonefish (Synanceja horrida) venom, for the first time from a marine source [Poh, Yuen, Chung & Khoo (1992) Comp. Biochem. Physiol., in the...

Drug-binding properties of human alpha-foetoprotein.

Hirano, K, Watanabe, Y, Adachi, T, Ito, Y, Sugiura, M

The drug-binding properties of human alpha-foetoprotein (alpha FP) were investigated by a fluorescence-spectral method. Human alpha FP was shown to bind to albumin's site I marker (warfarin,...

The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression

Shinozaki, K., Ohme, M., Tanaka, M., Wakasugi, T., Hayashida, N., Matsubayashi, T., ...

The complete nucleotide sequence (155 844 bp) of tobacco (Nicotiana tabacum var. Bright Yellow 4) chloroplast DNA has been determined. It contains two copies of an identical 25 339 bp inverted...

Both RNA editing and RNA cleavage are required for translation of tobacco chloroplast ndhD mRNA: a possible regulatory mechanism for the expression of a chloroplast operon consisting of functionally unrelated genes.

Hirose, T, Sugiura, M

Tobacco chloroplast genes encoding a photosystem I component (psaC) and a NADH dehydrogenase subunit (ndhD) are transcribed as a dicistronic pre-mRNA which is then cleaved into short mRNAs. An RNA...

Creation of a novel protein-coding region at the RNA level in black pine chloroplasts: the pattern of RNA editing in the gymnosperm chloroplast is different from that in angiosperms.

Wakasugi, T, Hirose, T, Horihata, M, Tsudzuki, T, Kössel, H, Sugiura, M

The phenomenon of RNA editing has been found to occur in chloroplasts of several angiosperm plants. Comparative analysis of the entire nucleotide sequence of a gymnosperm [Pinus thunbergii (black...

Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein.

Imai, S, Koizumi, S, Sugiura, M, Tokunaga, M, Uemura, Y, Yamamoto, N, ...

In 1000 primary gastric carcinomas, 70 (7.0%) contained Epstein-Barr virus (EBV) genomic sequences detected by PCR and Southern blots. The positive tumors comprised 8 of 9 (89%) undifferentiated...

High-level expression of human superoxide dismutase in the cyanobacterium Anacystis nidulans 6301.

Takeshima, Y, Takatsugu, N, Sugiura, M, Hagiwara, H

A chemically synthesized gene encoding human CuZn superoxide dismutase (hSOD) was cloned into the shuttle vector pBAX18R and expressed in Anacystis nidulans 6301 (Synechococcus sp. strain PCC 6301)...

Loss of all ndh genes as determined by sequencing the entire chloroplast genome of the black pine Pinus thunbergii.

Wakasugi, T, Tsudzuki, J, Ito, S, Nakashima, K, Tsudzuki, T, Sugiura, M

The complete nucleotide sequence (119,707 bp) of the black pine (Pinus thunbergii) chloroplast genome has been determined. It contains 4 rRNA genes and 32 tRNA genes. To our knowledge, the tRNAPro...

Identification of two essential sequence elements in the nonconsensus type II PatpB-290 plastid promoter by using plastid transcription extracts from cultured tobacco BY-2 cells.

Kapoor, S, Sugiura, M

In higher plants, plastid genes are transcribed by at least two types of DNA-dependent RNA polymerases. One of them is the well-known plastid-encoded prokaryotic type of polymerase that recognizes...

Plant cytosolic tRNAHis possesses an exceptional C54 in the canonical TPsiC loop.

Akama, K, Yukawa, Y, Sugiura, M, Small, I

A nuclear gene coding for tRNAHis from Arabidopsis has been reported to contain C54in the TPsiC loop, although the corresponding nucleotide is an invariant U or a derivative in nearly all other...

Molecular heterogeneity of photosystem I. psaD, psaE, psaF, psaH, and psaL are all present in isoforms in Nicotiana spp.

Obokata, J, Mikami, K, Hayashida, N, Nakamura, M, Sugiura, M

The protein composition of photosystem I (PSI) was examined in Nicotiana spp. by high-resolution polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and immunoblot analysis. Five...

Spontaneous establishment of an Epstein-Barr virus-infected fibroblast line from the synovial tissue of a rheumatoid arthritis patient.

Koide, J, Takada, K, Sugiura, M, Sekine, H, Ito, T, Saito, K, ...

An Epstein-Barr virus (EBV)-infected fibroblast line, designated DSEK, was spontaneously established from synovial tissue of a patient with rheumatoid arthritis (RA). DSEK cells expressed EBV nuclear...

Proline-hyperproducing strains of Serratia marcescens: enhancement of proline analog-mediated growth inhibition by increasing osmotic stress.

Sugiura, M, Kisumi, M

Proline-producing strains of Serratia marcescens were more osmotolerant than wild-type strains. Growth inhibition by proline analogs was significantly enhanced by increasing the osmotic stress of the...

Stabilization of a histidine-producing strain of Serratia marcescens.

Sugiura, M, Kisumi, M

A decrease in histidine productivity was observed during subculture of a histidine-producing strain of Serratia marcescens. The decrease was accompanied by an increase in the number of wild-type...

Norleucine accumulation by a norleucine-resistant mutant of Serratia marcescens.

Kisumi, M, Sugiura, M, Chibata, I

A norleucine-resistant mutant was derived from an isoleucine-valine auxotroph of a leucine accumulator of Serratia marcescens. The norleucine-resistant mutant could accumulate norleucine from...

Rapid detection of the mecA gene in methicillin-resistant staphylococci by enzymatic detection of polymerase chain reaction products.

Ubukata, K, Nakagami, S, Nitta, A, Yamane, A, Kawakami, S, Sugiura, M, ...

In order to identify methicillin-resistant staphylococci from clinical sources with ease and reliability, enzymatic detection of polymerase chain reaction (ED-PCR) was applied. ED-PCR is based on the...

DNA-DEPENDENT RNA-DIRECTED PROTEIN SYNTHESIS in vitro, I. EXTENT OF GENOME TRANSCRIPTION*

Bryan, R. N., Sugiura, M., Hayashi, M.

We have described an in vitro system which couples UTP incorporation into RNA by DNA-dependent RNA polymerase with RNA-directed amino acid incorporation into polypeptides. Using the technique of...

The existence of eukaryotic ribonucleoprotein consensus sequence-type RNA-binding proteins in a prokaryote, Synechococcus 6301.

Sugita, M, Sugiura, M

A group of proteins containing a conserved ribonucleoprotein consensus sequence (RNP-CS)-type RNA-binding domain (CS-RBD) of approximately 80 amino acids is present in eukaryotic cells and binds...

cDNA structure, expression and nucleic acid-binding properties of three RNA-binding proteins in tobacco: occurrence of tissue-specific alternative splicing.

Hirose, T, Sugita, M, Sugiura, M

Three cDNAs encoding RNA-binding proteins were isolated from a tobacco (Nicotiana sylvestris) cDNA library. The predicted proteins (RGP-1) are homologous to each other and consist of a...

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

Hori, H, Osawa, S, Takaiwa, F, Sugiura, M

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the...

The complete nucleotide sequence of a rice 17S rRNA gene.

Takaiwa, F, Oono, K, Sugiura, M

The complete nucleotide sequence of a rice nuclear 17S rRNA gene (rDNA) has been determined. The rice rDNA is 1812 bp long and its G + C content is 51.3%. This nucleotide sequence shows 79%, 80% and...

Locations and sequences of tobacco chloroplast genes for tRNAPro(UGG), tRNATrp, tRNAfMet and tRNAGly(GCC): the tRNAGly contains only two base-pairs in the D stem.

Ohme, M, Kamogashira, T, Shinozoki, K, Sugiura, M

The nucleotide sequences of tobacco chloroplast genes for tRNAPro(UGG), tRNATrp, tRNAfMet and tRNAGly(GCC) have been determined. None of these genes contains an intron. One unusual feature is that...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

Takaiwa, F, Kusuda, M, Sugiura, M

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be:...

Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

Takaiwa, F, Sugiura, M

The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which...

Sequence of the intercistronic region between the ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit and coupling factor beta subunit gene.

Shinozaki, K, Sugiura, M

The nucleotide sequence of the region between the genes for the large subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase and the beta subunit of coupling factor from tobacco chloroplast DNA...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Takaiwa, F, Sugiura, M

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence...

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU -...

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

Takaiwa, F, Sugiura, M

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be:...

A putative gene of tobacco chloroplast coding for ribosomal protein similar to E. coli ribosomal protein S19.

Sugita, M, Sugiura, M

A partial sequence of a cloned 3.2 Md BamHI fragment from tobacco chloroplast DNA revealed the occurrence of a putative gene for ribosomal protein. The putative gene is located on the left margin of...

Nucleotide sequence of tobacco chloroplast gene for the alpha subunit of proton-translocating ATPase.

Deno, H, Shinozaki, K, Sugiura, M

The tobacco chloroplast gene for the alpha subunit of proton-translocating ATPase has been cloned and sequenced. The coding region contains 1521 bp (507 codons). The nucleotide sequence and the...

The gene for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase is located close to the gene for the large subunit in the cyanobacterium Anacystis nidulans 6301.

Shinozaki, K, Sugiura, M

The gene for the small subunit (SS) of ribulose-1,5-bisphosphate carboxylase/oxygenase from a cyanobacterium, Anacystis nidulans 6301, has been cloned and subjected to sequence analysis. The SS...

The nucleotide sequences of tRNASer (GCU) and tRNAGln (UUG) genes from tobacco chloroplasts.

Deno, H, Sugiura, M

The nucleotide sequence of tobacco chloroplast genes for tRNASer (GCU) and tRNAGln (UUG) have been determined. These tRNA genes are encoded on the same DNA strand and separated by 1144 bp. Two open...

Nucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC): the tRNAVal (UAC) gene contains a long intron.

Deno, H, Kato, A, Shinozaki, K, Sugiura, M

The nucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC) have been determined. The tRNAVal gene contains a 571 base pairs intron located in the anticodon loop....

Elongation of oligonucleotides in the 3'-direction with activated mononucleotides and their analogs using RNA ligase.

Ohtsuka, E, Miyake, T, Nagao, K, Uemura, H, Nishikawa, S, Sugiura, M, ...

P1-Adenosine 5'-P2-2',3'-ethoxymethylidene nucleosides [A(5')ppN(Em)] from four common nucleosides have been prepared and used for single addition of nucleotides to elongate oligonucleotide chains in...

Sequence of a putative promoter region for the rRNA genes of tobacco chloroplast DNA.

Tohdoh, N, Shinozaki, K, Sugiura, M

The nucleotide sequence of the segment of tobacco chloroplast DNA adjacent to and including the start of the 16S rRNA gene has been determined. The region just preceding this gene was found to...

The nucleotide sequences of two tRNAAsn genes from tobacco chloroplasts.

Kato, A, Shimada, H, Kusuda, M, Sugiura, M

Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNAAsn in their 1.4 and...

Nucleic acid-binding specificities of tobacco chloroplast ribonucleoproteins.

Li, Y Q, Sugiura, M

Many ribonucleoproteins (RNPs) are involved in the regulation of gene expression at the post-transcriptional level. We previously isolated three nuclear-encoded RNPs from tobacco chloroplasts. Here...

Tobacco nuclear gene for the 31 kd chloroplast ribonucleoprotein: genomic organization, sequence analysis and expression.

Li, Y Q, Ye, L Z, Sugita, M, Sugiura, M

We have previously identified three chloroplast ribonucleoproteins and characterized their cDNAs. Here we present the genomic organization, sequence and expression of one of their genes. The 31 kd...

Diversity of a ribonucleoprotein family in tobacco chloroplasts: two new chloroplast ribonucleoproteins and a phylogenetic tree of ten chloroplast RNA-binding domains.

Ye, L H, Li, Y Q, Fukami-Kobayashi, K, Go, M, Konishi, T, Watanabe, A, ...

Two new ribonucleoproteins (RNPs) have been identified from a tobacco chloroplast lysate. These two proteins (cp29A and cp29B) are nuclear-encoded and have a less affinity to single-stranded DNA as...

Fine structural features of the chloroplast genome: comparison of the sequenced chloroplast genomes.

Shimada, H, Sugiura, M

The entire nucleotide sequences of the rice, tobacco and liverwort chloroplast genomes have been determined. We compared all the chloroplast genes, open reading frames and spacer regions in the...

Domains required for nucleic acid binding activities in chloroplast ribonucleoproteins.

Ye, L, Sugiura, M

Five ribonucleoproteins (or RNA-binding proteins) from tobacco chloroplasts have been identified to date; each of these contains an acidic N-terminal domain (24-64 amino acids) and two conserved...

An additional promoter within the protein-coding region of the psbD-psbC gene cluster in tobacco chloroplast DNA.

Yao, W B, Meng, B Y, Tanaka, M, Sugiura, M

Transcription of the psbD-psbC gene cluster in tobacco chloroplasts has been studied. This cluster contains in linear sequence the overlapping genes encoding the D2 and 43 kDa proteins of Photosystem...

Structure and cotranscription of tobacco chloroplast genes for tRNAGlu(UUC), tRNATyr(GUA) and tRNAAsp(GUC).

Ohme, M, Kamogashira, T, Shinozaki, K, Sugiura, M

The location and nucleotide sequences of tobacco chloroplast genes for tRNAGlu(UUC), tRNATyr(GUA) and tRNAAsp(GUC) have been determined. These genes lie midway between the genes for alpha and...

Joining of ribooligonucleotides with T4 RNA ligase and identification of the oligonucleotide-adenylate intermediate.

Ohtsuka, E, Nishikawa, S, Sugiura, M, Ikehara, M

T4 RNA ligase was found to join A-A-A-A-A-A and 32pU-U-U-U in the presence of ATP as cofactor. In this reaction the pyrophosphate of pU-U-U-U and pA was isolated by chromatography on a RPC-5 column,...

Genes for the eight ribosomal proteins are clustered on the chloroplast genome of tobacco (Nicotiana tabacum): similarity to the S10 and spc operons of Escherichia coli.

Tanaka, M, Wakasugi, T, Sugita, M, Shinozaki, K, Sugiura, M

The nucleotide sequence of a tobacco (Nicotiana tabacum) chloroplast gene cluster that encodes eight proteins homologous to Escherichia coli ribosomal proteins L23, L2, S19, L22, S3, L16, L14, and S8...

A novel RNA gene in the tobacco plastid genome: its possible role in the maturation of 16S rRNA.

Vera, A, Sugiura, M

A small plastid-encoded RNA (spRNA, 218 nt) has been detected in tobacco. The corresponding locus (sprA) does not contain any open reading frame and is actively transcribed from its own promoter, as...

A plant basal in vitro system supporting accurate transcription of both RNA polymerase II- and III-dependent genes: supplement of green leaf component(s) drives accurate transcription of a light-responsive rbcS gene.

Fan, H, Sugiura, M

An in vitro transcription initiation system has been developed from nuclei of rapidly growing, non-green tobacco (Nicotiana tabacum) cultured (BY-2) cells. Conditions for nuclear extraction and in...

Cis-acting elements and trans-acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts.

Hirose, T, Sugiura, M

Translational regulation is an important step of gene expression in chloroplasts. To analyze biochemical mechanisms of translational regulation unique to higher plant chloroplasts, an in vitro...

Three distinct ribonucleoproteins from tobacco chloroplasts: each contains a unique amino terminal acidic domain and two ribonucleoprotein consensus motifs.

Li, Y Q, Sugiura, M

Chloroplasts contain their own genetic system. Eighteen different split genes have been found among approximately 130 chloroplast genes from higher plants. However, little is known about the...

Identification of the reaction products of the purified hyaluronidase from stonefish (Synanceja horrida) venom.

Sugahara, K, Yamada, S, Sugiura, M, Takeda, K, Yuen, R, Khoo, H E, ...

Recently we purified to homogeneity hyaluronidase from stonefish (Synanceja horrida) venom, for the first time from a marine source [Poh, Yuen, Chung & Khoo (1992) Comp. Biochem. Physiol., in the...

Drug-binding properties of human alpha-foetoprotein.

Hirano, K, Watanabe, Y, Adachi, T, Ito, Y, Sugiura, M

The drug-binding properties of human alpha-foetoprotein (alpha FP) were investigated by a fluorescence-spectral method. Human alpha FP was shown to bind to albumin's site I marker (warfarin,...

The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression

Shinozaki, K., Ohme, M., Tanaka, M., Wakasugi, T., Hayashida, N., Matsubayashi, T., ...

The complete nucleotide sequence (155 844 bp) of tobacco (Nicotiana tabacum var. Bright Yellow 4) chloroplast DNA has been determined. It contains two copies of an identical 25 339 bp inverted...

Both RNA editing and RNA cleavage are required for translation of tobacco chloroplast ndhD mRNA: a possible regulatory mechanism for the expression of a chloroplast operon consisting of functionally unrelated genes.

Hirose, T, Sugiura, M

Tobacco chloroplast genes encoding a photosystem I component (psaC) and a NADH dehydrogenase subunit (ndhD) are transcribed as a dicistronic pre-mRNA which is then cleaved into short mRNAs. An RNA...

Enzyme immunoassay of pancreatic oncofetal antigen (POA) as a marker of pancreatic cancer.

Nishida, K, Sugiura, M, Yoshikawa, T, Kondo, M

For the quantitative measurement of pancreatic oncofetal antigen (POA), an enzyme immunoassay for POA has been developed, and is based on the sandwich method using antibody-coupled glass beads and...

Preservation of endothelium-dependent relaxation in cholesterol-fed and streptozotocin-induced diabetic mice by the chronic administration of cholestyramine.

Kamata, K., Sugiura, M., Kojima, S., Kasuya, Y.

1. Experiments were designed to investigate the effects of the low density lipoprotein (LDL)-lowering drugs cholestyramine on serum LDL levels and endothelium-dependent relaxation to acetylcholine...

Multiple regional 1H-MR spectroscopy in multiple system atrophy: NAA/Cr reduction in pontine base as a valuable diagnostic marker

Watanabe, H, Fukatsu, H, Katsuno, M, Sugiura, M, Hamada, K, Okada, Y, ...

Objective: We performed 1H-MR spectroscopy (1H-MRS) on multiple brain regions to determine the metabolite pattern and diagnostic utility of 1H-MRS in multiple system atrophy (MSA).

A randomised control study of partial liquid ventilation after airway lavage with exogenous surfactant in a meconium aspiration syndrome animal model

Nakamura, T., Matsuzawa, S., Sugiura, M., Tamura, M.

AIMS—To test the hypothesis that lavage with exogenous surfactant before partial liquid ventilation in meconium aspiration syndrome (MAS) would improve debris removal, and therefore the...

In vitro studies of mycoplasma-like organisms.

Sugiura, M., Shiomi, T., Nasu, S.

We determined whether the western X mycoplasma (WXM) isolated from Colladonus montanus could be maintained in vitro by ultrathin sections or by assay of infectivity. Large spherical or small...

Transcriptional analysis of Epstein-Barr virus gene expression in EBV-positive gastric carcinoma: unique viral latency in the tumour cells.

Sugiura, M., Imai, S., Tokunaga, M., Koizumi, S., Uchizawa, M., Okamoto, K., ...

Although case-oriented evidence for an association of Epstein-Barr virus (EBV) with gastric carcinoma has been accumulating recently, the interaction(s) between EBV and gastric epithelial cells...