Bending and Torsional Flexibility of G/C-rich Sequences as Determined by Cyclization Assays* (2008)
Mensur Dlakic, Rodney E. Harrington
The structural polymorphism of DNA is a vital aspect of its biological function. However, it has become increasingly apparent in recent years that DNA polymorphism is a complicated, multidimensional...
Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation (2007)
Dez, Christophe, Dlakic, Mensur, Tollervey, David
A family of HEAT-repeat containing ribosome synthesis factors was previously identified in Saccharomyces cerevisiae. We report the detailed characterization of two of these factors, Utp10 and Utp20,...
DUF283 domain of Dicer proteins has a double-stranded RNA-binding fold (2006)
Two RNases, Dicer and Argonaute, are at the heart of the RNA interference (RNAi) molecular machinery responsible for gene silencing. Both RNases contain multiple domains, most of which have been...
3D models of yeast RNase P/MRP proteins Rpp1p and Pop3p (2005)
Sensitive profile searches and fold recognition were used to predict the structures of two yeast RNase P/MRP proteins. Rpp1p, which is one of the subunits common to eukaryotes and archaea, is...
Oeffinger, Marlene, Dlakic, Mensur, Tollervey, David
Rrp12p (Ypl012w) is unusual among characterized ribosome synthesis factors in being associated with late precursors to both the 40S and 60S subunits. Rrp12p is predominately nuclear with nucleolar...
PIN domain of Nob1p is required for D-site cleavage in 20S pre-rRNA (2004)
FATICA, ALESSANDRO, TOLLERVEY, DAVID, DLAKIC, MENSUR
Nob1p (Yor056c) is essential for processing of the 20S pre-rRNA to the mature 18S rRNA. It is part of a pre-40S ribosomal particle that is transported to the cytoplasm and subsequently cleaved at the...
Oeffinger, Marlene, Dlakic, Mensur, Tollervey, David
Rrp12p (Ypl012w) is unusual among characterized ribosome synthesis factors in being associated with late precursors to both the 40S and 60S subunits. Rrp12p is predominately nuclear with nucleolar...
PIN domain of Nob1p is required for D-site cleavage in 20S pre-rRNA (2004)
FATICA, ALESSANDRO, TOLLERVEY, DAVID, DLAKIC, MENSUR
Nob1p (Yor056c) is essential for processing of the 20S pre-rRNA to the mature 18S rRNA. It is part of a pre-40S ribosomal particle that is transported to the cytoplasm and subsequently cleaved at the...
3D models of yeast RNase P/MRP proteins Rpp1p and Pop3p (2004)
Mutations that generate premature translation-termination codons (PTCs) often result in production of alternatively spliced mRNAs. While in many cases, the PTC-causing mutation was found to affect...
Oeffinger, Marlene, Dlakic, Mensur, Tollervey, David
Rrp12p (Ypl012w) is unusual among characterized ribosome synthesis factors in being associated with late precursors to both the 40S and 60S subunits. Rrp12p is predominately nuclear with nucleolar...
The replication fork blocks are common in both prokaryotes and eukaryotes. In most cases, these blocks are associated with increased levels of mitotic recombination. One of the best-characterized...
Getting DNA in shape by bending and kinking /--by Mensur Dlakic. (1997)
"Reno, September 1997."
Evidence for opposite groove-directed curvature of GGGCCC and AAAAA sequence elements (1993)
Brukner, Ivan, Dlakic, Mensur, Savic, Ana, Susic, Slavoljub, Pongor, Sándor, Suck, Dietrich
The repetitive sequence (AGGGCCCTAGAGGGGCCCTAG)n was previously shown to be curved by gel mobility assays. Here we show, using hydroxy radical/DNase I digestion and differential helical phasing...
Strained DNA is kinked by low concentrations of Zn2+
Han, Wenhai, Dlakic, Mensur, Zhu, Yinwen Judy, Lindsay, S. M., Harrington, Rodney E.
A novel atomic force microscope with a magnetically oscillated tip has provided unprecedented resolution of small DNA fragments spontaneously adsorbed to mica and imaged in situ in the presence of...
Douthit, Stephanie A., Dlakic, Mensur, Ohman, Dennis E., Franklin, Michael J.
The polysaccharide alginate forms a protective capsule for Pseudomonas aeruginosa during chronic pulmonary infections. The structure of alginate, a linear polymer of β1-4-linked O-acetylated...
Strained DNA is kinked by low concentrations of Zn2+
Han, Wenhai, Dlakic, Mensur, Zhu, Yinwen Judy, Lindsay, S. M., Harrington, Rodney E.
A novel atomic force microscope with a magnetically oscillated tip has provided unprecedented resolution of small DNA fragments spontaneously adsorbed to mica and imaged in situ in the presence of...
Douthit, Stephanie A., Dlakic, Mensur, Ohman, Dennis E., Franklin, Michael J.
The polysaccharide alginate forms a protective capsule for Pseudomonas aeruginosa during chronic pulmonary infections. The structure of alginate, a linear polymer of β1-4-linked O-acetylated...