Samanta, Suman K, Bhattacharya, Santanu, Maiti, Prabal K
The aggregation property of multiheaded surfactants has been investigated by constant pressure molecular dynamics (MD) simulation in aqueous medium. The model multiheaded surfactants contain more...
The Influence of Bilayer Composition on the Gel to Liquid Crystalline Transition (2009)
Debnath, Ananya, Ayappa, KG, Kumaran, V, Maiti, Prabal K
We report molecular dynamics simulations of bilayers using a united atom model with explicit solvent molecules. The bilayer consists of the single tail cationic surfactant behenyl trimethyl ammonium...
Jump Reorientation of Water Molecules Confined in Narrow Carbon Nanotubes (2009)
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, AK
We used molecular dynamics (MD) simulations to study the reorientational dynamics of water molecules confined inside narrow carbon nanotubes immersed in a bath of water. Our simulations show that the...
Structure of polyamidoamide dendrimers up to limiting generations : a mesoscale description (2009)
Maiti, Prabal K., Li, Youyong, Çağin, Tahir
The polyamidoamide (PAMAM) class of dendrimers was one of the first dendrimers synthesized by Tomalia and co-workers at Dow. Since its discovery the PAMAMs have stimulated many discussions on the...
Binding of DNA Nucleobases and Nucleosides with Graphene (2009)
Varghese, Neenu, Mogera, Umesha, Govindaraj, Achutharao, Das, Anindya, Maiti, Prabal K, Sood, Ajay K, ...
Interaction of two different samples of graphene with DNA nucleobases and nucleosides is investigated by isothermal titration calorimetry. The relative interaction energies of the nucleobases...
Force induced DNA melting (2009)
Santosh, Mogurampelly, Maiti, Prabal K
When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to...
The poly dA helix: a new structural motif for high performance DNA-based molecular switches (2009)
Chakraborty, Saikat, Sharma, Suruchi, Maiti, Prabal K., Krishnan, Yamuna
We report a pH-dependent conformational transition in short, defined homopolymeric deoxyadenosines (dA15) from a single helical structure with stacked nucleobases at neutral pH to a double-helical,...
Binding of DNA Nucleobases and Nucleosides with Graphene (2008)
Varghese, Neenu, Umesha, Mogera, Govindaraj , Achutharao, Das, Anindya, Maiti, Prabal K., Sood, A. K., ...
Interaction of two different samples of graphene with DNA nucleobases and nucleosides is investigated by isothermal titration calorimetry. The relative interaction energies of the nucleobases...
Force Induced DNA Melting (2008)
Santosh, Mogurampelly, Maiti, Prabal K
When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates roughly twice its initial contour length at a pulling force about 70 pN. The transition to this...
Mukherjee, Biswaroop, Maiti, Prabal K., Dasgupta, Chandan, Sood, Ajay K.
Molecular dynamics simulations of the orientational dynamics of water molecules confined in narrow carbon nanotubes and nanorings reveal that confinement leads to strong anisotropy in the...
Binding of nucleobases with single-walled carbon nanotubes: Theory and experiment (2008)
Das, Anindya, Sood, A. K., Maiti, Prabal K., Das, Mili, R., Varadarajan, Rao, C. N. R.
We report the binding energy of various nucleobases (guanine (G), adenine (A), thymine (T) and cytosine (C)) with (5,5) single-walled carbon nanotube (SWNT) calculated using first-principle...
Binding of nucleobases with single-walled carbon nanotubes: Theory and experiment (2008)
Das, Anindya, Sood, A. K., Maiti, Prabal K., Das, Mili, Varadarajan, R., Rao, C. N. R.
We report the binding energy of various nucleobases (guanine (G), adenine (A), thymine ( T) and cytosine ( C)) with (5,5) single-walled carbon nanotube(SWNT) calculated using first-principle...
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, Ajay K
Molecular dynamics simulations of the orientational dynamics of water molecules confined in narrow carbon nanotubes and nanorings reveal that confinement leads to strong anisotropy in the...
Counterion Distribution and \zeta -Potential in PAMAM Dendrimer (2008)
Maiti, Prabal K, Messina, Rene
Using several hundred nanosecond long fully atomistic molecular dynamics simulations, we investigate the monomer and counterion local concentrations in poly amido amide (PAMAM) dendrimer systems for...
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, Ajay K
Molecular dynamics simulations of the orientational dynamics of water molecules confined in narrow carbon nanotubes and nanorings reveal that confinement leads to strong anisotropy in the...
Counterion Distribution and \zeta -Potential in PAMAM Dendrimer (2008)
Maiti, Prabal K, Messina, Rene
Using several hundred nanosecond long fully atomistic molecular dynamics simulations, we investigate the monomer and counterion local concentrations in poly amido amide (PAMAM) dendrimer systems for...
Strong Correlations and Fickian Water Diffusion in Narrow Carbon Nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal K., Dasgupta, Chandan, Sood, A. K.
We have used atomistic molecular dynamics (MD) simulations to study the structure and dynamics of water molecules inside an open ended carbon nanotube placed in a bath of water molecules. The size of...
Binding of Nucleobases with Single-Walled Carbon Nanotubes (2007)
Das, Anindya, Sood, A. K., Maiti, Prabal K., Das, Mili, Varadarajan, R., Rao, C. N. R.
We have calculated the binding energy of various nucleobases (guanine (G), adenine (A), thymine (T) and cytosine (C)) with (5,5) single-walled carbon nanotubes (SWNTs) using ab-initio Hartre-Fock...
Understanding DNA based Nanostructures (2007)
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan
We use molecular dynamics (MD) simulations to understand the structure, and stability of various Paranemic crossover (PX) DNA molecules and their topoisomer JX molecules, synthesized recently by...
Understanding DNA based nanostructures (2007)
Maiti, Prabal K, Pascal, Tod A, Vaidehi, Nagarajan, Goddard, William A
We use molecular dynamics (MD) simulations to understand the structure, and stability of various Paranemic crossover (PX) DNA molecules and their topoisomer JX molecules, synthesized recently by...
Double-walled carbon nanotubes under hydrostatic pressure: Raman experiments and simulations (2007)
Gadagkar, Vikram, Saha, Surajit, Muthu, D. V. S., Maiti, Prabal K., Lansac, Yves, Jagota, A., ...
We have used Raman spectroscopy to study the behavior of double-walled carbon nanotubes (DWNT) under hydrostatic pressure. We find that the rate of change of the tangential mode frequency with...
Understanding DNA based nanostructures (2007)
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan, Goddard, William A.
We use molecular dynamics (MD) simulations to understand the structure, and stability of various Paranemic crossover (PX) DNA molecules and their topoisomer JX molecules, synthesized recently by...
Structure and dynamics of confined water inside narrow carbon nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal. K., Dasgupta, Chandan, Sood, A. K.
We have performed atomistic molecular dynamics (MD) simulations of water molecules inside narrow, open-ended carbon nanotubes placed in a bath of water molecules. The radius of the tube is such that...
Irreversible pressure-induced transformation of boron nitride nanotubes (2007)
Saha, Surajit, Gadagkar, Vikram, Maiti, Prabal K., Muthu, D. V. S., Golberg, Dmitri, Tang, C, ...
We have used Raman spectroscopy to study the behavior of multi-walled boron nitride nanotubes and hexagonal boron nitride crystals under high pressure. While boron nitride nanotubes show an...
Double-Walled Carbon Nanotubes Under Hydrostatic Pressure: Raman Experiments and Simulations (2007)
Gadagkar, Vikram, Saha, Surajit, Muthu, D. V. S, Maiti, Prabal. K., Lansac, Yves, Jagota, A, ...
We have used Raman spectroscopy to study the behavior of double-walled carbon nanotubes (DWNT) under hydrostatic pressure. We find that the rate of change of the tangential mode frequency with...
Structure and Dynamics of Confined Water Inside Narrow Carbon Nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, A.K.
We have performed atomistic molecular dynamics (MD) simulations of water molecules inside narrow, open-ended carbon nanotubes placed in a bath of water molecules. The radius of the tube is such that...
Strong correlations and Fickian water diffusion in narrow carbon nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal K., Dasgupta, Chandan, Sood, A. K
The authors have used atomistic molecular dynamics (MD) simulations to study the structure and dynamics of water molecules inside an open ended carbon nanotube placed in a bath of water molecules....
Strong correlations and Fickian water diffusion in narrow carbon nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, AK
The authors have used atomistic molecular dynamics (MD) simulations to study the structure and dynamics of water molecules inside an open ended carbon nanotube placed in a bath of water molecules....
Strong correlations and Fickian water diffusion in narrow carbon nanotubes (2007)
Mukherjee, Biswaroop, Maiti, Prabal K, Dasgupta, Chandan, Sood, AK
The authors have used atomistic molecular dynamics (MD) simulations to study the structure and dynamics of water molecules inside an open ended carbon nanotube placed in a bath of water molecules....
Maiti, Prabal K, Goddard III, William A
We have performed \sim20-40 ns of molecular dynamics (MD) simulations for the generation 8 PAMAM dendrimer in explicit water under varying pH conditions to study the structure of the dendrimer...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman, Hynes, James T
Recent time domain experiments have explored solvation dynamics of a probe located inside a DNA duplex, in an effort to gain information, e.g., on the dynamics of water molecules in the DNA major and...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman
Dynamics of water molecules in the grooves of DNA are of great interest both for practical functionality of DNA and fundamental as examples of confined systems interest. Here the authors employ...
Maiti, Prabal K., Bagchi, Biman
We study sequence dependent complexation between oligonucleotides (single strand DNA) and various generation ethylene diamine (EDA) cored poly amido amide (PAMAM) dendrimers through atomistic...
Jana, Chandan, Jayamurugan, G., Ganapathy, R., Maiti, Prabal K., Jayaraman, N., Sood, A. K.
We study the structure of carboxylic acid terminated neutral poly (propyl ether imine) (PETIM) dendrimer from generation 1 through 6 (G1-G6) in a good solvent (water) by fully atomistic molecular...
Entropy of Water in the Hydration Layer of Major and Minor Grooves of DNA (2006)
Jana, Biman, Pal, Subrata, Maiti, Prabal K, Lin, Shiang Tai, Hynes, James T, Bagchi, Biman
Transport properties (translational and rotational) of water in the two grooves of the B-DNA duplex are known to be different from those in the bulk. Here, we use a recently developed theoretical...
Jana, Chandan, Jayamurugan, G, Ganapathy, Rajesh, Maiti, Prabal K, Jayaraman, N, Sood, AK
We study the structure of carboxylic acid terminated neutral poly(propyl ether imine)(PETIM) dendrimer from generations 1–6(G1–G6)in a good solvent (water)by fully atomistic molecular dynamics...
Maiti, Prabal K, Pascal, Tod A, Vaidehi, Nagarajan, Heo, Jiyoung, Goddard, William A
We use molecular dynamics (MD) simulations to understand the structure and stability of various paranemic crossover (PX) DNA molecules, synthesized recently by Seeman and co-workers at New York...
Collapse of double-walled carbon nanotube bundles under hydrostatic pressure (2006)
Gadagkar, Vikram, Maiti, Prabal K, Lansac, Yves, Jagota, A, Sood, AK
We use classical molecular dynamics simulations to study the collapse of single (SWNT) and double-walled (DWNT) carbon nanotube bundles under hydrostatic pressure. The collapse pressure (p(c)) varies...
Collapse of Double-Walled Carbon Nanotube Bundles under Hydrostatic Pressure (2006)
Gadagkar, Vikram, Maiti, Prabal K., Lansac, Yves, Jagota, A., Sood, A. K.
We use classical molecular dynamics simulations to study the collapse of single (SWNT) and double-walled (DWNT) carbon nanotube bundles under hydrostatic pressure. The collapse pressure (pc) varies...
Maiti, Prabal K, Pascal, Tod A, Vaidehi, Nagarajan, Heo, Jiyoung, Goddard, William A
We use molecular dynamics (MD) simulations to understand the structure and stability of various paranemic crossover (PX) DNA molecules, synthesized recently by Seeman and co-workers at New York...
Jana, Chandan, Jayamurugan, G, Ganapathy, Rajesh, Maiti, Prabal K, Jayaraman, N, Sood, AK
We study the structure of carboxylic acid terminated neutral poly(propyl ether imine)(PETIM) dendrimer from generations 1–6(G1–G6)in a good solvent (water)by fully atomistic molecular dynamics...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman, Hynes, James T
Recent time domain experiments have explored solvation dynamics of a probe located inside a DNA duplex, in an effort to gain information, e.g., on the dynamics of water molecules in the DNA major and...
Maiti, Prabal K, Goddard III, William A
We have performed \sim20-40 ns of molecular dynamics (MD) simulations for the generation 8 PAMAM dendrimer in explicit water under varying pH conditions to study the structure of the dendrimer...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman
Dynamics of water molecules in the grooves of DNA are of great interest both for practical functionality of DNA and fundamental as examples of confined systems interest. Here the authors employ...
Prabal K. Maiti, Nagarajan Vaidehi, Jiyoung Heo
ABSTRACT We use molecular dynamics (MD) simulations to understand the structure and stability of various paranemic crossover (PX) DNA molecules, synthesized recently by Seeman and co-workers at New...
Collapse of double-walled carbon nanotube bundles under hydrostatic pressure (2006)
Maiti, Prabal K., Gadagkar, Vikram, Lansac, Yves, Jagota, A., Sood, A. K.
We use classical molecular dynamics simulations to study the collapse of single (SWNT) and double-walled (DWNT) carbon nanotube bundles under hydrostatic pressure. The collapse pressure (pc) varies...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG)...
Pal, Subrata, Maiti, Prabal K, Bagchi, Biman
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG)...
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan
We use molecular dynamics simulations in explicit water and salt (Na+) to determine the effect of varying the number of crossover points on the structure and stability of the PX65 paranemic crossover...
Maiti, Prabal K, Pascal, Tod A, Vaidehi, Nagarajan, Goddard, William A
We use molecular dynamics simulations in explicit water and salt $(Na^+)$ to determine the effect of varying the number of crossover points onthe structure and stability of the PX65 paranemic...
Maiti, Prabal K, Pascal, Tod A, Vaidehi, Nagarajan, Goddard, William A
We use molecular dynamics simulations in explicit water and salt $(Na^+)$ to determine the effect of varying the number of crossover points onthe structure and stability of the PX65 paranemic...
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan, Goddard, William A.
We use molecular dynamics simulations in explicit water and salt (Na+) to determine the effect of varying the number of crossover points on the structure and stability of the PX65 paranemic...
Entropy driven formation of Smectic C in system of Zig-zag shaped molecules (2003)
Maiti, Prabal K., Lansac, Yves, Glaser, Matthew A., Clark, Noel A.
We have carried out Monte Carlo simulations of zig-zag shaped molecules where the the molecules is composed of three rigidly linked hard spherocylinder arranged in a zigzag fashion. By varying zigzag...
Coarse-grained simulation of polymer translocation through an artificial nanopore (2003)
Lansac, Yves, Maiti, Prabal K., Glaser, Matthew A.
The translocation of a macromolecule through a nanometer-sized pore is an interesting process with important applications in the development of biosensors for single--molecule analysis and in drug...
Phase Behavior of Bent-Core Molecules (2002)
Lansac, Yves, Maiti, Prabal K., Clark, Noel A., Glaser, Matthew A.
Recently, a new class of smectic liquid crystal phases (SmCP phases) characterized by the spontaneous formation of macroscopic chiral domains from achiral bent-core molecules has been discovered. We...
Maiti, Prabal K., Lansac, Yves, Glaser, Matthew A., Clark, Noel A.
Recent experiments indicate that doping low concentrations of bent-core molecules into calamitic smectic solvents can induce anticlinic and biaxial smectic phases. We have carried out Monte Carlo...
Self-assembly in Lyotropic Chromonic Liquid Crystals (2001)
Maiti, Prabal K., Lansac, Yves, Glaser, Matthew A., Clark, Noel A.
We have developed a class of idealized models of chromonic molecules which are miscible in water, but which can form aggregates which in turn organize into lyotropic liquid crystal (LC) phases. By...
Cross-linking of micelles by gemini surfactants (1999)
Maiti, Prabal K., Kremer, Kurt, Flimm, Oliver, Chowdhury, Debashish, Stauffer, Dietrich
We investigate the effects of gemini surfactants, telechelic chain and lipids on the nature of micelles formed by conventional single-tail surfactants in water by carrying out Monte Carlo...
Kinetics of Phase ordering in Microemulsions and Micellar Solutions (1997)
Chowdhury, Debashish, Maiti, Prabal K.
We review the models developed and techniques used in recent years to study the kinetics of phase ordering in a class of complex fluids, namely, ternary microemulsions and micellar solutions.
Maiti, Prabal K., Chowdhury, Debashish
We report the results of large scale Monte Carlo (MC) simulations of novel microscopic models of gemini surfactants to elucidate (i) their spontaneous aggregation in bulk water and (ii) their spatial...
Micellar Aggregates of Gemini Surfactants: Monte Carlo Simulation of a Microscopic Model (1997)
Maiti, Prabal K., Chowdhury, Debashish
We propose a "microscopic" model of gemini surfactants in aqueous solution. Carrying out extensive Monte Carlo simulations, we study the variation of the critical micellar concentration (CMC) of...
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan, Goddard, William A.
We use molecular dynamics simulations in explicit water and salt (Na+) to determine the effect of varying the number of crossover points on the structure and stability of the PX65 paranemic crossover...
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan, Goddard, William A.
We use molecular dynamics simulations in explicit water and salt (Na+) to determine the effect of varying the number of crossover points on the structure and stability of the PX65 paranemic crossover...
Atomic-Level Simulations of Seeman DNA Nanostructures: The Paranemic Crossover in Salt Solution
Maiti, Prabal K., Pascal, Tod A., Vaidehi, Nagarajan, Heo, Jiyoung, Goddard, William A.
We use molecular dynamics (MD) simulations to understand the structure and stability of various paranemic crossover (PX) DNA molecules, synthesized recently by Seeman and co-workers at New York...
The poly dA helix: a new structural motif for high performance DNA-based molecular switches
Chakraborty, Saikat, Sharma, Suruchi, Maiti, Prabal K., Krishnan, Yamuna
We report a pH-dependent conformational transition in short, defined homopolymeric deoxyadenosines (dA15) from a single helical structure with stacked nucleobases at neutral pH to a double-helical,...